Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circ_001988 | |||
Gene | FBXW7 | Organism | Human |
Genome Locus | chr4:153332454-153333681:- | Build | hg19 |
Disease | Colorectal Cancer | ICD-10 | Malignant neoplasm of rectosigmoid junction (C19) |
DBLink | Link to database | PMID | 26884878 |
Experimental Method | |||
Sample Type | Placental Tissues | Comparison | 40 placental tissues from Pre-Eclampsia (PE) patients and 35 placental tissues from gestational age-matched patients who gave premature birth |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward CCAGTAGTATTGTGGACCTGCCC ReverseCCCTCTGACCCAGTAACTCCACT | Statistics | Fold Change : Downregulated pvalue : p<0.001 |
Citation | |||
Wang, X, Zhang, Y, Huang, L, Zhang, J, Pan, F, Li, B, Yan, Y, Jia, B, Liu, H, Li, S, Zheng, W (2015). Decreased expression of hsa_circ_001988 in colorectal cancer and its clinical significances. Int J Clin Exp Pathol, 8, 12:16020-5. |